ID: 978659550_978659555

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 978659550 978659555
Species Human (GRCh38) Human (GRCh38)
Location 4:111108331-111108353 4:111108349-111108371
Sequence CCAGACCTCAGGAGAACTCAATC CAATCACAAGAACAGCAAGGGGG
Strand - +
Off-target summary No data {0: 7, 1: 260, 2: 1116, 3: 2587, 4: 4946}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!