ID: 978947961_978947966

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 978947961 978947966
Species Human (GRCh38) Human (GRCh38)
Location 4:114521768-114521790 4:114521815-114521837
Sequence CCTCATAGATCCTGGATAGCAGT AATATTTTCTCCCACTCTGTGGG
Strand - +
Off-target summary No data {0: 235, 1: 3706, 2: 14984, 3: 17298, 4: 9215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!