ID: 979017332_979017335

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 979017332 979017335
Species Human (GRCh38) Human (GRCh38)
Location 4:115451285-115451307 4:115451320-115451342
Sequence CCAACTTGATTACATTCTCCCTG ACACCAATCAAATGTAGATTTGG
Strand - +
Off-target summary {0: 1, 1: 51, 2: 1294, 3: 2931, 4: 4097} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!