ID: 979257371_979257385

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 979257371 979257385
Species Human (GRCh38) Human (GRCh38)
Location 4:118619325-118619347 4:118619377-118619399
Sequence CCACCCCAGACTCCCAAGTAGCT CTGGCTAATGTTTCTTTTTTTGG
Strand - +
Off-target summary {0: 33, 1: 496, 2: 14727, 3: 30337, 4: 46849} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!