ID: 979257373_979257385

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 979257373 979257385
Species Human (GRCh38) Human (GRCh38)
Location 4:118619328-118619350 4:118619377-118619399
Sequence CCCCAGACTCCCAAGTAGCTGGA CTGGCTAATGTTTCTTTTTTTGG
Strand - +
Off-target summary {0: 85, 1: 6786, 2: 109153, 3: 219239, 4: 254838} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!