ID: 979293459_979293464

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 979293459 979293464
Species Human (GRCh38) Human (GRCh38)
Location 4:119003651-119003673 4:119003688-119003710
Sequence CCCTCCCAGTATAGTCTCTATGT TTTAGTATCTTTTATAGTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 75, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!