ID: 979318926_979318929

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 979318926 979318929
Species Human (GRCh38) Human (GRCh38)
Location 4:119300542-119300564 4:119300568-119300590
Sequence CCTGCAGCTTCGTAACAACCCTA ACCGAAAATGCTTAAGTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57} {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!