ID: 979323834_979323839

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 979323834 979323839
Species Human (GRCh38) Human (GRCh38)
Location 4:119355747-119355769 4:119355791-119355813
Sequence CCAGATGGCCTCATTAGCTTTTG GTAAGGCATTTGAAAAACCTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 132} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!