ID: 979403317_979403323

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 979403317 979403323
Species Human (GRCh38) Human (GRCh38)
Location 4:120277954-120277976 4:120277981-120278003
Sequence CCCTAACAAAGCCCTGTTAATGC ATTACAGTTCCAAATAGAATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!