ID: 979475534_979475540

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 979475534 979475540
Species Human (GRCh38) Human (GRCh38)
Location 4:121152862-121152884 4:121152895-121152917
Sequence CCACTGTGCCTCTGGTGCCTAAT GCACAAAAATCCTACCTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 367} {0: 1, 1: 0, 2: 0, 3: 26, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!