ID: 979492006_979492011

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 979492006 979492011
Species Human (GRCh38) Human (GRCh38)
Location 4:121338897-121338919 4:121338928-121338950
Sequence CCTCCATGTAATCCTTTCCTTAC CATCCCCACATGCTGTTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 253} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!