ID: 979509690_979509696

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 979509690 979509696
Species Human (GRCh38) Human (GRCh38)
Location 4:121538193-121538215 4:121538225-121538247
Sequence CCTCCAGCTCCATCCAAGTTGCT CATTATTTCATTCCTTAGTATGG
Strand - +
Off-target summary {0: 255, 1: 1104, 2: 3654, 3: 6523, 4: 7230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!