ID: 979509691_979509696

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 979509691 979509696
Species Human (GRCh38) Human (GRCh38)
Location 4:121538196-121538218 4:121538225-121538247
Sequence CCAGCTCCATCCAAGTTGCTGCC CATTATTTCATTCCTTAGTATGG
Strand - +
Off-target summary {0: 6, 1: 260, 2: 1189, 3: 4271, 4: 8645} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!