ID: 979509692_979509698

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 979509692 979509698
Species Human (GRCh38) Human (GRCh38)
Location 4:121538202-121538224 4:121538243-121538265
Sequence CCATCCAAGTTGCTGCCAAAAGC TATGGCTGAGTAGTATTCCATGG
Strand - +
Off-target summary No data {0: 793, 1: 2575, 2: 28071, 3: 15480, 4: 7359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!