ID: 979536195_979536202

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 979536195 979536202
Species Human (GRCh38) Human (GRCh38)
Location 4:121823452-121823474 4:121823477-121823499
Sequence CCGCGGGTTCCCGGACTTCAGTA GCCAGCGCGGCCCGGGTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 67} {0: 1, 1: 1, 2: 2, 3: 23, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!