ID: 979536206_979536215

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 979536206 979536215
Species Human (GRCh38) Human (GRCh38)
Location 4:121823488-121823510 4:121823529-121823551
Sequence CCGGGTCCGCGGTTGTTGGACGG TGATATTCTCCTGGTCCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 16} {0: 1, 1: 0, 2: 0, 3: 14, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!