ID: 979547265_979547279

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 979547265 979547279
Species Human (GRCh38) Human (GRCh38)
Location 4:121951938-121951960 4:121951986-121952008
Sequence CCCGGGGCCGAGCGGGGCTCTGG CGGCGGCGGCGATGCCTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 311} {0: 1, 1: 0, 2: 1, 3: 17, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!