ID: 979561915_979561918

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 979561915 979561918
Species Human (GRCh38) Human (GRCh38)
Location 4:122110394-122110416 4:122110420-122110442
Sequence CCGACCAACTTAAAAAACGGCGC ATGAGATTATATCCCACACCTGG
Strand - +
Off-target summary No data {0: 19, 1: 435, 2: 1820, 3: 1963, 4: 1386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!