ID: 979561915_979561919

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 979561915 979561919
Species Human (GRCh38) Human (GRCh38)
Location 4:122110394-122110416 4:122110428-122110450
Sequence CCGACCAACTTAAAAAACGGCGC ATATCCCACACCTGGCTCAGAGG
Strand - +
Off-target summary No data {0: 430, 1: 875, 2: 1411, 3: 1503, 4: 1255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!