ID: 979563389_979563392

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 979563389 979563392
Species Human (GRCh38) Human (GRCh38)
Location 4:122125621-122125643 4:122125662-122125684
Sequence CCATTTGTATATTTGTAGTATTT AGGTGCCTAAGAGGCAGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 100, 4: 1010} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!