ID: 979565796_979565799

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 979565796 979565799
Species Human (GRCh38) Human (GRCh38)
Location 4:122152694-122152716 4:122152724-122152746
Sequence CCTGCGGCGGCGACTCCTTCATA GCCATCCTTACCTACAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 46} {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!