|
Left Crispr |
Right Crispr |
Crispr ID |
979607139 |
979607145 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:122650726-122650748
|
4:122650741-122650763
|
Sequence |
CCTGTAATCCCAGCACTTTGTGA |
CTTTGTGAGGCCAAGGTGGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 1786, 1: 298626, 2: 265319, 3: 148850, 4: 129231} |
{0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|