ID: 979607139_979607145

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 979607139 979607145
Species Human (GRCh38) Human (GRCh38)
Location 4:122650726-122650748 4:122650741-122650763
Sequence CCTGTAATCCCAGCACTTTGTGA CTTTGTGAGGCCAAGGTGGATGG
Strand - +
Off-target summary {0: 1786, 1: 298626, 2: 265319, 3: 148850, 4: 129231} {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!