ID: 979664193_979664199

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 979664193 979664199
Species Human (GRCh38) Human (GRCh38)
Location 4:123293011-123293033 4:123293064-123293086
Sequence CCAGACCAGCACGAAAGCAATCT CTGGATATTCAGATCAGACGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 96} {0: 1, 1: 1, 2: 1, 3: 3, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!