ID: 979664194_979664199

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 979664194 979664199
Species Human (GRCh38) Human (GRCh38)
Location 4:123293016-123293038 4:123293064-123293086
Sequence CCAGCACGAAAGCAATCTGCCTC CTGGATATTCAGATCAGACGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 30, 4: 385} {0: 1, 1: 1, 2: 1, 3: 3, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!