ID: 979911072_979911074

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 979911072 979911074
Species Human (GRCh38) Human (GRCh38)
Location 4:126366313-126366335 4:126366327-126366349
Sequence CCAGGAATCCTAAATAATCACAT TAATCACATTACCTATCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!