ID: 980302763_980302773

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 980302763 980302773
Species Human (GRCh38) Human (GRCh38)
Location 4:131015006-131015028 4:131015046-131015068
Sequence CCCAGTCTTTGGGCTTACCTTTT CAAAATATGCAAATGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 285} {0: 1, 1: 1, 2: 5, 3: 47, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!