ID: 980302768_980302776

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 980302768 980302776
Species Human (GRCh38) Human (GRCh38)
Location 4:131015029-131015051 4:131015081-131015103
Sequence CCTCCTGGCTGGCTCGTCAAAAT TGGCATCTTGAACAAAGAATCGG
Strand - +
Off-target summary No data {0: 88, 1: 211, 2: 280, 3: 306, 4: 890}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!