ID: 980406018_980406020

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 980406018 980406020
Species Human (GRCh38) Human (GRCh38)
Location 4:132354805-132354827 4:132354841-132354863
Sequence CCACAATCACTCAAGAAATGTGA TTTTCTACTTTTCTAGGTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 161, 3: 193, 4: 774}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!