ID: 980442301_980442305

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 980442301 980442305
Species Human (GRCh38) Human (GRCh38)
Location 4:132865188-132865210 4:132865214-132865236
Sequence CCACTGCGCCAGGCCAGCTTTTG TCTTAACAAAGAAAGGTCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!