ID: 980614078_980614086

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 980614078 980614086
Species Human (GRCh38) Human (GRCh38)
Location 4:135195202-135195224 4:135195220-135195242
Sequence CCCAGGAGGTGGGGCCTGGTGGG GTGGGAGGTGTTTGGGTCATGGG
Strand - +
Off-target summary No data {0: 432, 1: 1386, 2: 3977, 3: 6258, 4: 9921}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!