ID: 980614078_980614087

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 980614078 980614087
Species Human (GRCh38) Human (GRCh38)
Location 4:135195202-135195224 4:135195221-135195243
Sequence CCCAGGAGGTGGGGCCTGGTGGG TGGGAGGTGTTTGGGTCATGGGG
Strand - +
Off-target summary No data {0: 521, 1: 1544, 2: 4567, 3: 7515, 4: 12263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!