ID: 980884146_980884149

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 980884146 980884149
Species Human (GRCh38) Human (GRCh38)
Location 4:138743767-138743789 4:138743797-138743819
Sequence CCTGTTATTCATAAGGATACCTA TTGAGTATTTACTATATGCTAGG
Strand - +
Off-target summary No data {0: 3, 1: 16, 2: 148, 3: 975, 4: 3408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!