ID: 980957729_980957732

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 980957729 980957732
Species Human (GRCh38) Human (GRCh38)
Location 4:139445887-139445909 4:139445925-139445947
Sequence CCTGACATCTTCTGCAGATAACT GACAGCTTTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 5, 1: 211, 2: 170, 3: 137, 4: 213} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!