ID: 981049059_981049063

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 981049059 981049063
Species Human (GRCh38) Human (GRCh38)
Location 4:140293181-140293203 4:140293217-140293239
Sequence CCAACAGAATGTTTTCTCACATG CTGGGCTGCCACTAGGTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 489} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!