ID: 981100575_981100578

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 981100575 981100578
Species Human (GRCh38) Human (GRCh38)
Location 4:140825526-140825548 4:140825567-140825589
Sequence CCTTTCTGTCTGTTAGTTTTCCT GTTAGCTGCACCTCAGCTGCAGG
Strand - +
Off-target summary {0: 26, 1: 5689, 2: 2357, 3: 602, 4: 702} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!