ID: 981100577_981100581

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 981100577 981100581
Species Human (GRCh38) Human (GRCh38)
Location 4:140825546-140825568 4:140825585-140825607
Sequence CCTTCTAACAGGTGTGTTGCAGT GCAGGTGTGTTGGAGTTTGCTGG
Strand - +
Off-target summary No data {0: 36, 1: 2101, 2: 2139, 3: 1193, 4: 782}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!