ID: 981100577_981100582

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 981100577 981100582
Species Human (GRCh38) Human (GRCh38)
Location 4:140825546-140825568 4:140825588-140825610
Sequence CCTTCTAACAGGTGTGTTGCAGT GGTGTGTTGGAGTTTGCTGGCGG
Strand - +
Off-target summary No data {0: 32, 1: 2000, 2: 2972, 3: 1507, 4: 1097}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!