ID: 981260737_981260742

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 981260737 981260742
Species Human (GRCh38) Human (GRCh38)
Location 4:142715719-142715741 4:142715772-142715794
Sequence CCTAACAAATTATCCCAACATTT TAACCATCTGCATTTTAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 46, 4: 359} {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!