ID: 981284384_981284392

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 981284384 981284392
Species Human (GRCh38) Human (GRCh38)
Location 4:142998252-142998274 4:142998286-142998308
Sequence CCTCCCACCTCAGCCTCTTACAG CAGGTGTGAGGCACTGTGCTTGG
Strand - +
Off-target summary {0: 2, 1: 93, 2: 2639, 3: 32793, 4: 96910} {0: 4, 1: 408, 2: 7915, 3: 31094, 4: 79718}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!