ID: 981296652_981296664

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 981296652 981296664
Species Human (GRCh38) Human (GRCh38)
Location 4:143140632-143140654 4:143140679-143140701
Sequence CCAGTACAGCAGTCTGAAGTCAA GGAGGGGCCCACCATTACAGAGG
Strand - +
Off-target summary {0: 12, 1: 225, 2: 418, 3: 604, 4: 474} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!