ID: 981331393_981331403

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 981331393 981331403
Species Human (GRCh38) Human (GRCh38)
Location 4:143513977-143513999 4:143514018-143514040
Sequence CCAAGCCCGCAGCCTCGATCGCC AGCAACAAAGGCGGCCCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 122} {0: 1, 1: 0, 2: 0, 3: 6, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!