ID: 981385863_981385868 |
View in Genome Browser |
Spacer: 9 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 981385863 | 981385868 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:144129852-144129874 | 4:144129884-144129906 |
Sequence | CCCAGTGGGAAAGGAGAGCAGAG | TGGCTTTGCCACCAAATGGTTGG |
Strand | - | + |
Off-target summary | {0: 3, 1: 1, 2: 6, 3: 51, 4: 428} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |