ID: 981385863_981385868

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 981385863 981385868
Species Human (GRCh38) Human (GRCh38)
Location 4:144129852-144129874 4:144129884-144129906
Sequence CCCAGTGGGAAAGGAGAGCAGAG TGGCTTTGCCACCAAATGGTTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 6, 3: 51, 4: 428} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!