ID: 981385864_981385868 |
View in Genome Browser |
Spacer: 8 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 981385864 | 981385868 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:144129853-144129875 | 4:144129884-144129906 |
| Sequence | CCAGTGGGAAAGGAGAGCAGAGT | TGGCTTTGCCACCAAATGGTTGG |
| Strand | - | + |
| Off-target summary | {0: 3, 1: 0, 2: 3, 3: 38, 4: 333} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||