ID: 981479982_981479985

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 981479982 981479985
Species Human (GRCh38) Human (GRCh38)
Location 4:145228589-145228611 4:145228616-145228638
Sequence CCTCAAAGGCCATGCTGGGAGAA TGCTCTCTTCAGAGCACAGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 30, 4: 227} {0: 1, 1: 3, 2: 12, 3: 137, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!