ID: 981479983_981479985

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 981479983 981479985
Species Human (GRCh38) Human (GRCh38)
Location 4:145228598-145228620 4:145228616-145228638
Sequence CCATGCTGGGAGAACCACTGCTC TGCTCTCTTCAGAGCACAGTTGG
Strand - +
Off-target summary {0: 354, 1: 791, 2: 515, 3: 258, 4: 382} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!