ID: 981517397_981517407

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 981517397 981517407
Species Human (GRCh38) Human (GRCh38)
Location 4:145624814-145624836 4:145624857-145624879
Sequence CCTCCTCTACCTTACATGGGTCC ATCCTCTGTAACCATGCTGGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 112} {0: 2, 1: 1, 2: 0, 3: 22, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!