ID: 981782849_981782855

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 981782849 981782855
Species Human (GRCh38) Human (GRCh38)
Location 4:148445453-148445475 4:148445472-148445494
Sequence CCGGTCCCCTCGCTCTGACGGCG GGCGGCTCAGACGCCCGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!