ID: 981794173_981794181 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 981794173 | 981794181 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:148576828-148576850 | 4:148576853-148576875 |
| Sequence | CCTCCTGCCTCAGCCTCCTGAGT | CTGGGACTACAGGCATTATCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 7, 3: 116, 4: 428} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||