ID: 981794176_981794181

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 981794176 981794181
Species Human (GRCh38) Human (GRCh38)
Location 4:148576835-148576857 4:148576853-148576875
Sequence CCTCAGCCTCCTGAGTAGCTGGG CTGGGACTACAGGCATTATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 116, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!