ID: 981842096_981842106

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 981842096 981842106
Species Human (GRCh38) Human (GRCh38)
Location 4:149124455-149124477 4:149124479-149124501
Sequence CCAGGCTGCAGGAATATTATAGG TTAGGTTTGGTGGGAAGGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!